circad | circRNAs associated with diseases

hsa_circ_0001649
Gene		Organism	Human
Genome Locus	chr6:146209155-146216113 :-	Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink	Link to database	PMID	31137016
Experimental Method
Sample Type	Tissues	Comparison	77 pairs of HCC and adjacent no-tumor tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AATGCTGAAAACTGCTGAGAGAA Reverse TTGAGAAAACGAGTGCTTTGG	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Su, Y, Xu, C, Liu, Y, Hu, Y, Wu, H (2019). Circular RNA hsa_circ_0001649 inhibits hepatocellular carcinoma progression via multiple miRNAs sponge. Aging (Albany NY), 11, 10:3362-3375.